EST details — SGN-E474345

Search information 
Request: 474345Match: SGN-E474345
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C222972Clone name: cSTB-36-O23
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E474345Length: 288 bp (459 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E474345 [] (trimmed) ACCTTCTATAGTCAAGATACCAGCGATCTTCACGAGAGGGTGGATTTTGTTGCGTGTTTGGGAGGAGATGGTGTGATACTCCATGCATCAAATAT
ATTTCGAGGTGCTGTCCCACCCGTCATCTCATTTAACCTAGGATCCCTTGGATTTCTCACTTCCCATCCATTTGAAGATTATAAGAAGGATCTTA
CAAAAGTCATCCATGGAAACAACACTCTAGATGGTGTGTATATAACCCTAATGATGCGTCTCCGATGTGAGATATTCCTAAGCGGGAAAGCAATG
CCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E474345] SGN-U296646 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T219566 [Download][View] Facility Assigned ID: PSHFK96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0120 Quality Trim Threshold: 14.5