EST details — SGN-E474440

Search information 
Request: 474440Match: SGN-E474440
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C222797Clone name: cSTB-36-F5
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E474440Length: 281 bp (1031 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E474440 [] (trimmed) AAGATTTAAACTTTACATTTGGTTAACAGAAATATGCAGAGCTTCAAATCAACATCTATTTTGAGGCGTTTTCTGCAGAAATCCCGGTTGGTTTC
TCAGTCCAGAAGCTTTTGCGGTGTTTCTAGCCATGTCATAATCGATGAACCCGAAAGCACAGTTTTAGTGGAGGGGAAAGCTTCTTCAAGAACAG
CGATTCTTAACAGACCCCATGTGTTAAATGCCATCAATTATTCACTTGGGTCAAGGTTGATGAAGCTGTACAAAAGTTGGGAGGATGATCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E474440] SGN-U284252 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T219661 [Download][View] Facility Assigned ID: PSHFM27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0188 Quality Trim Threshold: 14.5