EST details — SGN-E475771

Search information 
Request: 475771Match: SGN-E475771
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C224067Clone name: cSTB-41-B4
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E475771Length: 328 bp (877 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E475771 [] (trimmed) GAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTCCATGTCTGAAACATCTAATTAAGAATAAAAAATTACTTATCACTCCAACACAACCTTTTGTG
ATATACATTTATTCATACTTTCAACAACAAAACTATTACCTACTAAAACACTATATATATATATATATATATATATATATATATATATATATAAC
CACAATGGATATTCTTCATAGATATTCTTTAGTCATTAATTAATTAGATCAAGGAAGTCTCTCGGTTTTGAAAAGTCCTCCTTTTCCTCCAATTC
CTGGAAGTCCTCCGATTCCTCCAAATCCTGGAAGTCCTCCGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E475771] SGN-U298869 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T220992 [Download][View] Facility Assigned ID: PSHGH02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.880 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5