EST details — SGN-E476035

Search information 
Request: 476035Match: SGN-E476035
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C224784Clone name: cSTB-43-I15
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E476035Length: 351 bp (849 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E476035 [] (trimmed) TTTTCCCCTAGTACATACAATACAAGTGTTGGCACAGCTCTACATCCAAACCAGATACCTAAAAGAAAAATGGCTACAAAGTTGTGGGCTTCAAG
GGCTGCTTCATATCTCAGGATCTCAGCATTTCACAGGGCTTTTGCCACTGTGCCCAAGGATTTGAAGTACACAGAATCTCATGAATGGGTTAAAG
TTGATGGTAATTCTGCAACAATTGGCATCACTGATCATGCTCAGAAACATTTAGGTGATGTTGTTTACGTTGAATTTCCTGAAGTTGGGTCTTCT
GTGGAACAATTTGGCAGTTTTGGTGCTGTTGAAAGTGTCAAGGCTTCCAGCGATATCAATTCTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E476035] SGN-U276501 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T221256 [Download][View] Facility Assigned ID: PSHGM56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0127 Quality Trim Threshold: 14.5