EST details — SGN-E476150
Search information |
Request: 476150 | Match: SGN-E476150 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C224661 | Clone name: cSTB-43-B7 |
| ||
Library Name: cSTB | Organism: Solanum tuberosum |
Tissue: leaves and petioles
Development Stage: 8 weeks old plants
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E476150 | Length: 206 bp (947 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E476150 [] (trimmed)
AATACAGAGATGGACAAAGTATACACTGTCATGGGTGTATGCCCTCAGCATGACTTGCTTTGGGATACATTAACAGGAAGGGAGCACCTACTTTT
CTATGGAAGGCTTAAAAATCTTAAAGGAGAAGTTTTACATCGAGCAGTTGAAGACTCTCTTAAGAGTCTCAACTTGTTTAACGGAGGCGTTGCTG
ACAAGCAATCTGGGAG
CTATGGAAGGCTTAAAAATCTTAAAGGAGAAGTTTTACATCGAGCAGTTGAAGACTCTCTTAAGAGTCTCAACTTGTTTAACGGAGGCGTTGCTG
ACAAGCAATCTGGGAG
Unigenes |
Current Unigene builds | |||||
[SGN-E476150] | SGN-U293780 | Solanum tuberosum | Build 4 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T221371 [Download][View] | Facility Assigned ID: PSHGO04TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.971 | Expected Error Rate: 0.0274 | Quality Trim Threshold: 14.5 |