Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E478060

Search information 
Request: 478060Match: SGN-E478060
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C229920Clone name: cSTD-2-N24
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E478060Length: 429 bp (983 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E478060 [] (trimmed) GTCAAGGAGGCTCTGAAAGAACTGGTGATGCTGCCTCTTGAAGGAGCGGAATTGTTTTGTAAAGGACAGCTGACCAAGCCTTGCAAGGGAATATT
GCTCTTTGGACCTCCAGGTACCGGTAAAACAATGCTTGCAAAAGCTGTTGCTACTGAAGCTGGTGCAAACTGTGGGGCATATCAATGTCAAGCAT
TACATCCAAGTGGTTCGGTGAAGGGGAGAAGTATGTCAAAGCAGTCTTCACGTTAGCTAGTAAAATAGCTCCTAGTGTTGTTTTCGTTGACGAGG
TGGACAGCATGTTGGGAAGACGAGAAAATCCGGGAGAGCATGAAGCTATGCGGAAGATGAAGAATGAATTCATGGTTAATTGGGATGGTTTGCGT
ACGAAAGACAAGGAACGGGTTCTTGTACTTGCTGCAACAAATAGACCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E478060] SGN-U288071 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T223281 [Download][View] Facility Assigned ID: PTDAH84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0149 Quality Trim Threshold: 14.5