Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E478486

Search information 
Request: 478486Match: SGN-E478486
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C231114Clone name: cSTD-5-K21
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E478486Length: 314 bp (995 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E478486 [] (trimmed) GGCATAGAAGAACCTTTCAGCCGTCAGGGCTCTATGCAGCTCGAGTTGATATGCAGGGCTTCATCCCGGTGCTATAGGATTTGGGGGGAATGGCG
TTAAGCTAAGGCGTGGATATGCTCTTCCTCAGTCCCCGAAACCAACACAGGATGAAGTACGTCAACAAAAGGAGGAAGAAATGGATGATTACTGC
TCACAGGTCCCTGTTCGACATCTGGTGTTCATGGTTCACGGGATTGGTCAAAGGTTGGAAAAATCAAATCTTGTGGATGATGTTAGTGACTTTCG
CCATATCACGTCAATCCTCGCTGAACGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E478486] SGN-U293909 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T223707 [Download][View] Facility Assigned ID: PTDAQ71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0075 Quality Trim Threshold: 20.5