EST details — SGN-E478678

Search information 
Request: 478678Match: SGN-E478678
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C231232Clone name: cSTD-6-F3
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E478678Length: 200 bp (936 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E478678 [] (trimmed) AAATTCTTAAAGATCGGCCATCATGGTTTCGTGACTGCCGAGCAGTGGATGTTCTCAATGTGATGTCCACTGGAAATGGTGGAACCATTGAATTG
ATATACATGCAGCTCTATGCACCTACTACACTGGCACCAGCTCGTGACTTTTGGTTAATGCGATATACATCTGTTATGGAAGATGGTAGCCTTGT
GATATGTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E478678] SGN-U291719 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T223899 [Download][View] Facility Assigned ID: PTDAW26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0150 Quality Trim Threshold: 14.5