EST details — SGN-E478807
Search information |
Request: 478807 | Match: SGN-E478807 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C231486 | Clone name: cSTD-7-K11 |
| ||
Library Name: cSTD | Organism: Solanum tuberosum |
Tissue: dormant tuber
Development Stage: one month post harvest
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E478807 | Length: 188 bp (877 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E478807 [] (trimmed)
CTTTTAGGGTTCCATCGCTCACACACACTCTCTTCACTCTCCGGTGGATCTCCAAATTCTCCGACGAAAAAGGTCCTGTGCGACTGATGACGACG
GACACACAAAGTATTGCTGCTATAGCTGAGCAAATATGGATTGTTGCGAATTCAGGCTCTTATTGGAGGGAAATGGGTTGATGCATGTGATGG
GACACACAAAGTATTGCTGCTATAGCTGAGCAAATATGGATTGTTGCGAATTCAGGCTCTTATTGGAGGGAAATGGGTTGATGCATGTGATGG
Unigenes |
Current Unigene builds | |||||
[SGN-E478807] | SGN-U287454 | Solanum tuberosum | Build 4 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T224028 [Download][View] | Facility Assigned ID: PTDAY66TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.962 | Expected Error Rate: 0.0184 | Quality Trim Threshold: 14.5 |