Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E479447

Search information 
Request: 479447Match: SGN-E479447
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C232003Clone name: cSTD-9-N6
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E479447Length: 492 bp (966 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E479447 [] (trimmed) AAGTGATGGGTCAAAGTTTAGAGTTTCTCATCTGATCGTCACAGTACATATACATTATACCAACTTAATCACTGGAGAGACCTCATACAGCAAGC
TTTCTCTTGTTGATTTGGCTGGAAGTGAAAGCACTATTGAAGAGGATAGTGGCGAGCATGCAACAGAGTTGCTTCATGTCATGAAATCTCTTTCT
GCATTGGGAGATGTTTTGAATTCCTTGACATCAAAAAAAGACATTGTTCCATATGGAAATTCAATGCTCACCAAAATACTTGCAGACTCACTAGG
TGAAAGTGCAAAGACGCTTCTGATTGTTAATGTCTGTCCGAATGCTTCAAATTTGTCTGAGACATTATCCTCCCTCAATTTTTCTGCTAGAGCTA
GAAATGCCACACTAAGCCTTGGGAATCGAGATACAATCAAGAAATGGAGAGATATTGCCAATGATACACGCAAGGAACTTTATGACAAGGAGAAA
GAGATTACTGATCTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E479447] SGN-U294186 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T224668 [Download][View] Facility Assigned ID: PTDBJ75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5