EST details — SGN-E484240

Search information 
Request: 484240Match: SGN-E484240
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C232776Clone name: cSTE-12-J5
nocartOrdering Not Available
Library Name: cSTEOrganism: Solanum tuberosum

Tissue: periderm and subperiderm
Development Stage: 24 and 48 hour, and 5 and 7 day

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E484240Length: 306 bp (951 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E484240 [] (trimmed) CGGATATGGGCAGGGAAAGACCATTGGCAGTGATAGCATTACTCAAAAGATATCATGCTGAAAAAAATGGCTGGTGCTCTGTCTCCGGCCACCAC
CATCCGCCTTAAACCCTTCTACGCCGTCCGGTTCTTCACTCATTACAGAAGTCCTATCAAAGTCTTAAACCCCAATTTCTACTCATCATACCCTC
CAAAGCTGCATCCAACACCCTACTTGAGCCGTGGACGGAGCTATTCTGACTACTAGAGGGTTCCGCCGCTATTTCATCCGGAGAAGCAGTTGAAA
GACCCAAATTTGAGAATATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E484240] SGN-U288935 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T229461 [Download][View] Facility Assigned ID: PTEBU51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0260 Quality Trim Threshold: 14.5