EST details — SGN-E496249

Search information 
Request: 496249Match: SGN-E496249
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C291711Clone name: KS07046A06
nocartOrdering Not Available
Library Name: KS07Organism: Capsicum annuum

Tissue: Flower bud
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E496249Length: 347 bp (918 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E496249 [] (trimmed) AATTAGTCAGCATTTGAGTAGGAAGGATTTTAAATTGTGTTTGGTTTTGTTGAATCAGCTGGTTGGGTTGTGTGGGGAGGGTGATCCAAACGTGT
TATCGAAATTAGGATATGTGAAAATGCAGTATGGTGATGTGGAGGGAGCGAAAAAGGCGTTTAAATTGGTGGAGGGGATGGTAAATAGTGGCACT
GAAGTGTGCTTGAGGAATTTACTGAGTACGAATAAGGCATTGTTGTTTATAGTGGAAAAGGATTATGTGTCTGCAGTGAGGGAATACCAACAGTG
CATCCAGAGGGATGGGATGGATATGGTGGCCATGAATAATAACGCCTTGTGTTTGATGTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E496249] SGN-U201799 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T298415 [Download][View] Facility Assigned ID: KS07046A06
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0233 Quality Trim Threshold: 14.5