EST details — SGN-E497225

Search information 
Request: 497225Match: SGN-E497225
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C290374Clone name: KS07017E11
nocartOrdering Not Available
Library Name: KS07Organism: Capsicum annuum

Tissue: Flower bud
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E497225Length: 192 bp (1051 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E497225 [] (trimmed) TTACAGAGGATGTTGATGGACCTAGAATGTCTGGTTCTGACTCCTCTAATGATGATGAGGAGGAGGATGAAGACGAAAATGCACGTCTCGATCAT
GTTCTGAGTGATTTGAGTACGTTTGATATGGCCAATGGACTTGCTTCTAATGAAGCATCTCGTAGAAAGATGCCCTGAACTGCGCCCCATGCACG
AC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E497225] SGN-U205487 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T297078 [Download][View] Facility Assigned ID: KS07017E11
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0159 Quality Trim Threshold: 14.5