EST details — SGN-E497225
| Search information |
| Request: 497225 | Match: SGN-E497225 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C290374 | Clone name: KS07017E11 |
| ||
| Library Name: KS07 | Organism: Capsicum annuum |
Tissue: Flower bud
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E497225 | Length: 192 bp (1051 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E497225 [] (trimmed)
TTACAGAGGATGTTGATGGACCTAGAATGTCTGGTTCTGACTCCTCTAATGATGATGAGGAGGAGGATGAAGACGAAAATGCACGTCTCGATCAT
GTTCTGAGTGATTTGAGTACGTTTGATATGGCCAATGGACTTGCTTCTAATGAAGCATCTCGTAGAAAGATGCCCTGAACTGCGCCCCATGCACG
AC
GTTCTGAGTGATTTGAGTACGTTTGATATGGCCAATGGACTTGCTTCTAATGAAGCATCTCGTAGAAAGATGCCCTGAACTGCGCCCCATGCACG
AC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E497225] | SGN-U205487 | Capsicum annuum | Build 1 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T297078 [Download][View] | Facility Assigned ID: KS07017E11 |
| Submitter: Kribb | Sequencing Facility: KRIBB |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.960 | Expected Error Rate: 0.0159 | Quality Trim Threshold: 14.5 |


