EST details — SGN-E501498
Search information |
Request: 501498 | Match: SGN-E501498 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C301181 | Clone name: KS09079C04 |
| ||
Library Name: KS09 | Organism: Capsicum annuum |
Tissue: Young fruit (0.5-2 cm)
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E501498 | Length: 305 bp (908 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E501498 [] (trimmed)
GGCAACTAATGAAAATCTCCCACCAAATGTGATAAAACAATTGGCAAAGGAACTGAAAAATCTTGATGAAACTCCTCCTGAGGGCATCAAAGTTG
GTGTAAACGATGATGATTTTTCAACCATATTTGCTGATATTGAGGGCCCAGCTGGGACTCCTTACGAGAACGGGGTTTTCCGCATGAAGTTGATT
TTGACACATGATTTCCCTCATTCCCCACCAAAAGGTTATTTTCTGACCAAGANTTTCCATCCCCAACATTGCTTCCAATGGTGAGATCTGTGTCA
ACGCTTTGAAAAAAGATTGG
GTGTAAACGATGATGATTTTTCAACCATATTTGCTGATATTGAGGGCCCAGCTGGGACTCCTTACGAGAACGGGGTTTTCCGCATGAAGTTGATT
TTGACACATGATTTCCCTCATTCCCCACCAAAAGGTTATTTTCTGACCAAGANTTTCCATCCCCAACATTGCTTCCAATGGTGAGATCTGTGTCA
ACGCTTTGAAAAAAGATTGG
Unigenes |
Current Unigene builds | |||||
[SGN-E501498] | SGN-U204015 | Capsicum annuum | Build 1 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T307885 [Download][View] | Facility Assigned ID: KS09079C04 |
Submitter: Kribb | Sequencing Facility: KRIBB |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.946 | Expected Error Rate: 0.0191 | Quality Trim Threshold: 14.5 |