EST details — SGN-E501544

Search information 
Request: 501544Match: SGN-E501544
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C301227Clone name: KS09080B08
nocartOrdering Not Available
Library Name: KS09Organism: Capsicum annuum

Tissue: Young fruit (0.5-2 cm)
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E501544Length: 310 bp (831 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E501544 [] (trimmed) GAACTAGTCTCGAGTTTTCTTTTTTTTTTTTTAAATTTAAATAGCTCTTCTTTAAAGAGACTCCTGACCATTTTAGCAAGGACAAATTAGGTGGA
GGGGATTATTTATAGACCAATTTATAGTTACATACATTACTCCATCATAATAAAATACATTCAGATACTAAATTAAATTCTCTGCGTCATGAGTT
GCCACCAGGATAAGTACAGCCATTGTAACTAGGATTTGTTGAGGTGAGGGTCGCGGTCTGAGAGAAGTCGCACTTCCAGGGATTCCTGCCAGCAG
TTTGATAAAGAATATTCATAGCATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E501544] SGN-U204891 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T307931 [Download][View] Facility Assigned ID: KS09080B08
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0114 Quality Trim Threshold: 14.5