Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E501594

Search information 
Request: 501594Match: SGN-E501594
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C301277Clone name: KS09081C09
nocartOrdering Not Available
Library Name: KS09Organism: Capsicum annuum

Tissue: Young fruit (0.5-2 cm)
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E501594Length: 469 bp (850 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E501594 [] (trimmed) GAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTTTTTTAAAATCGAAGATCGTAAAAATACTATCAAATTTGTTACAAAATGAGTACACAAC
AAGAAAAGAAGAGGATCCTAGGCTGCTTTCATCTGATGCCATATTATCGGCGTTCCATAATATCATTCTGATTCGCTCATAGACTGACAAACAGG
AAGGTAATACGTATCTAACTGCCAGTACTTCTGTTTAACACCCTCCCACACTGATTCACTTAAACAATCCCTCACTGGTAATGGTATCAGCTGTG
TAGAATATCCTAAGCTCTCAAGTTCTAGAGAGACTAACTGAGAGTAAACGATATGAAAGAAAGGGTTACCTCCACATAGACCATTAAAAAATGAA
TATATCCCACCAGGCTTCAATAATCTAGGAAGATGTTGATGAAATTCCCGCATATCTTCCTAATATTCGCCATAAGTATCACAAAATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E501594] SGN-U203495 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T307981 [Download][View] Facility Assigned ID: KS09081C09
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0167 Quality Trim Threshold: 14.5