EST details — SGN-E505341
Search information |
Request: 505341 | Match: SGN-E505341 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C295456 | Clone name: KS10002F01 |
| ||
Library Name: KS10 | Organism: Capsicum annuum |
Tissue: Hairy root
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E505341 | Length: 287 bp (1489 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E505341 [] (trimmed)
ACTATTGAAACACCACCTACTCCTACCGCTGACCCCGGAACTCCAAGCACTCCAGGTGGTGGTGGCTACTATCCTTCGCCTACACCTACACCTAC
CACCCCCTCTACACCTACCATTGAAACACCACCTACGCCTACCGTTGACCCCTGGTACTCCAAGCACTCCAGGTGGTGGTGGNTACTATCCTTCG
CCTACACCTACACCTACCANCCCATCTACACCTACCATTGAAACAACACCTACGCCTACCGTTGACCCTGGTTACTCCAACCACTCCAGGGGGTG
GT
CACCCCCTCTACACCTACCATTGAAACACCACCTACGCCTACCGTTGACCCCTGGTACTCCAAGCACTCCAGGTGGTGGTGGNTACTATCCTTCG
CCTACACCTACACCTACCANCCCATCTACACCTACCATTGAAACAACACCTACGCCTACCGTTGACCCTGGTTACTCCAACCACTCCAGGGGGTG
GT
Unigenes |
Current Unigene builds | |||||
[SGN-E505341] | SGN-U202006 | Capsicum annuum | Build 1 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T302160 [Download][View] | Facility Assigned ID: KS10002F01 |
Submitter: Kribb | Sequencing Facility: KRIBB |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.901 | Expected Error Rate: 0.0268 | Quality Trim Threshold: 14.5 |