Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E505401

Search information 
Request: 505401Match: SGN-E505401
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C295516Clone name: KS10003D02
nocartOrdering Not Available
Library Name: KS10Organism: Capsicum annuum

Tissue: Hairy root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E505401Length: 431 bp (1600 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E505401 [] (trimmed) CAACCAATTCCTTCTCCCTTATTCTGCCAATTATTTTCCTAAATAAAAATGTCCACTTCCATTTTCCTCCTCTGGCTTGTTAGCATTCCTCTAAC
AATTCATGCCACCACTAATCCACATCCACCCCAAGGTTTCCTCTTAAATTGTGGTGGTGGGAAACTGGAACAAGATTCGTTGACATACCTACCAG
ATGATAAGTCTATACACACGGGGAATAAAACGGAGATAAAACAACAAGGGATAGTGCCATTGCTGTCCTCTGTTCGTTATTTTCCGGATCTGGTG
GAAGAGAAATCCTGCTATCAATTACCACTGAATAAAGGGAGGAAATTGCTGGTGAAAACTATATATTATTATGGACGTTTTGACGGAGGAACTGT
GCCACCAGTATTTGATCAACTCATTGATGGCACCAACTGGAATATTGATAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E505401] SGN-U199436 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T302220 [Download][View] Facility Assigned ID: KS10003D02
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0155 Quality Trim Threshold: 14.5