EST details — SGN-E507823

Search information 
Request: 507823Match: SGN-E507823
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C302288Clone name: KS11015D12
nocartOrdering Not Available
Library Name: KS11Organism: Capsicum annuum

Tissue: Early root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E507823Length: 377 bp (1344 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E507823 [] (trimmed) CTTTGAAGCATCTCCTTCAGAAGAACGTCAAATGCCGGAACTTATTAGAAAATGATGCTGGAGGTGGCTCTGTTTCTGGTGCCATAGCGAAATAT
CTGCCTTATGCAACTGACCCTAACCTTAGCGGTGCACTTGCTTCAGTGCTTTGGGAGCTGAACCTCTTGTCAAAGCATTACCACTCAGCTGTTTC
TACATTGGCATCCAACATTTCTATGTTGAGCACTAGTGATAACCAGATTCACCTGTCCAACAAATCTCCGCAACAAGCTTTTAAGGAGTTGTCAC
TTGAGCAGGAATCGTTCAGCGTAAAACTTGACCCCAAAAACTCAAATGCCAAGAGAAAAAAAGGGAATGCCTCACTAAAGAATAATAGTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E507823] SGN-U205184 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T308992 [Download][View] Facility Assigned ID: KS11015D12
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0230 Quality Trim Threshold: 14.5