Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E508374

Search information 
Request: 508374Match: SGN-E508374
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C303431Clone name: KS11034A07
nocartOrdering Not Available
Library Name: KS11Organism: Capsicum annuum

Tissue: Early root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E508374Length: 201 bp (806 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E508374 [] (trimmed) CATACTTTTTCTCCACTTCCAACAATGGCAGCCCCAATGGTCCTCGATCCAAAACCCTTACCCGAACCTCCCGCAATCCGACACGACTCATCCTC
CCACGAAATCCACATCGAAAACGGCGAAGACGATCTCTACGCTCGCCTGAAATCCCTCCAACGGCAGCTGGAATTCATCGAGATCCAAGAAGAAT
ATGTGAAAGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E508374] SGN-U202201 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T310135 [Download][View] Facility Assigned ID: KS11034A07
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0138 Quality Trim Threshold: 14.5