EST details — SGN-E508374
Search information |
Request: 508374 | Match: SGN-E508374 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C303431 | Clone name: KS11034A07 |
| ||
Library Name: KS11 | Organism: Capsicum annuum |
Tissue: Early root
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E508374 | Length: 201 bp (806 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E508374 [] (trimmed)
CATACTTTTTCTCCACTTCCAACAATGGCAGCCCCAATGGTCCTCGATCCAAAACCCTTACCCGAACCTCCCGCAATCCGACACGACTCATCCTC
CCACGAAATCCACATCGAAAACGGCGAAGACGATCTCTACGCTCGCCTGAAATCCCTCCAACGGCAGCTGGAATTCATCGAGATCCAAGAAGAAT
ATGTGAAAGAC
CCACGAAATCCACATCGAAAACGGCGAAGACGATCTCTACGCTCGCCTGAAATCCCTCCAACGGCAGCTGGAATTCATCGAGATCCAAGAAGAAT
ATGTGAAAGAC
Unigenes |
Current Unigene builds | |||||
[SGN-E508374] | SGN-U202201 | Capsicum annuum | Build 1 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T310135 [Download][View] | Facility Assigned ID: KS11034A07 |
Submitter: Kribb | Sequencing Facility: KRIBB |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.933 | Expected Error Rate: 0.0138 | Quality Trim Threshold: 14.5 |