EST details — SGN-E508651

Search information 
Request: 508651Match: SGN-E508651
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C301555Clone name: KS11001C04
nocartOrdering Not Available
Library Name: KS11Organism: Capsicum annuum

Tissue: Early root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E508651Length: 377 bp (1545 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E508651 [] (trimmed) GGATGATGAGAGCTTGAGAAGGTGGAAAGAAAAACTGCTTGGTTGCTTGGAAAGTGACTTAAATGGACAAATGGAACCTGAAGTTAAGTTCCACT
CAGTTGGAATCCTTTCGTCTGACTTTGGGGAGATAAATACTCCATTACCAATTAAAGAAGAACAAAGCAAATCTGTTCTCTTTACGCTCAGGGAG
GGCTCTGAGTATCGGCTTAAGCTAACATTTAGTGTTCTGCACAACATTGTTTCTGGTTTGGCCTACACAAATACAGTATGGAACGCTGGTCTTCA
AGTTGATCAAAGTAAGGGAATGCTTGGAACCTTCGCTCCTCAGCGAGAACCTTACATACATATCTCACAAGAGGAGACCACTCCATCAGGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E508651] SGN-U200430 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T308259 [Download][View] Facility Assigned ID: KS11001C04
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0185 Quality Trim Threshold: 14.5