Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E514405

Search information 
Request: 514405Match: SGN-E514405
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308287Clone name: cSML-10-P9
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308287 [cSML-10-P9] Trace: SGN-T315279 EST: SGN-E514406 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E514405Length: 457 bp (647 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E514405 [] (trimmed) GCTTCCCCTCTAGGGTTTTAGCACGATGCAACCGGCGGCAAGTTCAGTTGTTCCACCACCTATGGCGGCGCATCCACAGTACCAGCAGCAATGGA
TGGCTCAGCAACCACAGTACCAGGTTCCGCCACCGCAGTCCGGTTATTACTACCAGCAACCACCACCGCAGCAGCAGCAGCAGCAACAATCTCAG
TACACGGGTTCGGCTCAACCGACCAATGCTGATGAAGTCCGGACGCTTTGGATTGGGGATCTACAGTATTGGATGGATGAACAGTACCTATATAG
TTGCTTTGCGCAAACTGGAGAGGTGGTCTCTGCTAAAGTTATCCGCAACAAGCAAACTCAACAATCAGAGGGTTATGGCTTTATTGAGTTTAACA
GTCATGCAGCTGCAGAAAGGAATCTACAAGCATACAGTGGCACCTTGATGCCTAATATTGAGCAAAATTTTAGGCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E514405] SGN-U206785 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T315278 [Download][View] Facility Assigned ID: cC-smflcSML10P9c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0115 Quality Trim Threshold: 14.5