EST details — SGN-E515125

Search information 
Request: 515125Match: SGN-E515125
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308695Clone name: cSML-12-B9
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308695 [cSML-12-B9] Trace: SGN-T315999 EST: SGN-E515126 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E515125Length: 154 bp (1105 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E515125 [] (trimmed) ACAAGATGAGTCTTTCAGTGGCGCAGGGTTTTACGAAGTCTCTGGCGATGACTGTGCTGTCTGAGATCGGAGACAAGACTTTCTTCGCCGCCGCG
ATCTTGGCGATGCGTCATCCTAGGAGACTCGTCTTGTCAGGCTGCCTTGGGGCTTTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E515125] SGN-U206630 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T315998 [Download][View] Facility Assigned ID: cC-smflcSML12B9c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0050 Quality Trim Threshold: 20.5