| SGN ID: SGN-C308695 | Clone name: cSML-12-B9 |  | Ordering Not Available |
|
| Library Name: cSML | Organism: Solanum melongena |
Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E515125 | Length: 154 bp (1105 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E515125 [] (trimmed)
ACAAGATGAGTCTTTCAGTGGCGCAGGGTTTTACGAAGTCTCTGGCGATGACTGTGCTGTCTGAGATCGGAGACAAGACTTTCTTCGCCGCCGCG
ATCTTGGCGATGCGTCATCCTAGGAGACTCGTCTTGTCAGGCTGCCTTGGGGCTTTGAT
[BLAST] [AA Translate]
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: No vector sequence detected
Passed all screens and filters
| Sequence Entropy: 0.919 |
Expected Error Rate: 0.0050 |
Quality Trim Threshold: 20.5 |