EST details — SGN-E515800

Search information 
Request: 515800Match: SGN-E515800
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C309057Clone name: cSML-13-I10
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C309057 [cSML-13-I10] Trace: SGN-T316672 EST: SGN-E515799 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E515800Length: 444 bp (646 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E515800 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTCATGAAATAACACTGAATTATATAATTAAAATAATTACTTGATGAAAATCTTTCCACGTCAAGAAAACCAAA
CACATAATTAAAATAATTAAGTCATACATGCCGCCATGGTCTTTCAGCAAGATTTACACAATCATTATGCCTAAAACAATCAACCAAATGATCAA
TTGTCATTCCAGAGGCTTGCATGAATGAATAAACAATTACTGGTCCAACAAATCTGAATCCTTTCTTCAATAAATCTTTGCTAATTGTTTCTGCT
TTGGGTGTTCTTAATGGAACATTTCTTGGATGTCTAAATCTGTTAATTATAGGTTTATAATTCACATAATTCCACATGTAGCTGCTGAATGATCC
ATATTCTCTCACAACCTTGACTATGCATTTGGCATTGGCAACTATGCATCTAATTCTGCTTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E515800] SGN-U207404 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T316673 [Download][View] Facility Assigned ID: cC-smflcSML13I10d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.917 Expected Error Rate: 0.0097 Quality Trim Threshold: 14.5