EST details — SGN-E516076

Search information 
Request: 516076Match: SGN-E516076
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C309213Clone name: cSML-13-O21
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C309213 [cSML-13-O21] Trace: SGN-T316948 EST: SGN-E516075 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E516076Length: 384 bp (614 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E516076 [] (trimmed) TTTTTTTTTTTTTTTTTTTTCATGTACTGCTTGAATCTTGACACAGGTGACTATTTTCAAACACAAGTTTTGAGAACCATCGTTTTACATGCTGC
CATTATCGATTTATGATCTAAGTTCAGAATATATAGAAGATTCGGGCATACATTATTCAGAGAAATGCTCAAAACTCGAAGTAAGTAGGTCGAGA
AAAAAAAGTTACAGAAGCTTTACAACCTCACTTAACAACAAATGGACAGAGATATTGCAGCCATCTCATCCCCCTTATATGGATGCAAAGTATTC
TTTGCTGCCCTTGGGATCTGGCTTCATTGACTTGTCACCAGGCTTCCACCCAGCTGGGCATACCTCGTCTGGATTCTCCTGAACGTATTGCAATG
CCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E516076] SGN-U206713 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T316949 [Download][View] Facility Assigned ID: cC-smflcSML13O21d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0132 Quality Trim Threshold: 14.5