Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E516153

Search information 
Request: 516153Match: SGN-E516153
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C309258Clone name: cSML-14-A19
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E516153Length: 209 bp (635 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E516153 [] (trimmed) CAGCCGTTCATTCCTGCCCGTCATCCGATCGGGCAGCATTACTAGCCTTCCGTGCTGCCCTAAATGAACCTTACTTGGGAATTTTCAACTCATGG
AAAGGTTACGACTGTTGCCATGAATGGTACGGGGTGAGTTGCGATCCCATAACTCACCGTGTAGCTGACATCAACCTCCGAGGAGAATCAGAGGA
TCCACTCTTCGAAAAAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E516153] SGN-U207397 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T317026 [Download][View] Facility Assigned ID: cC-smflcSML14A19c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.990 Expected Error Rate: 0.0102 Quality Trim Threshold: 20.5