Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E517071

Search information 
Request: 517071Match: SGN-E517071
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C309764Clone name: cSML-15-F20
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C309764 [cSML-15-F20] Trace: SGN-T317943 EST: SGN-E517070 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E517071Length: 413 bp (569 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E517071 [] (trimmed) TTTTTTTTTTTTTTTTTTAAATGTCAAGAAAAACATATCTGAACTTGTACCAAATGAGAAATGTTTAAACCAGTCAAAACACTAAAGGGCATAAA
TACCAGAAAACCAGAAACACCAATATGAGAAAATTGTGCGCCATGCCTAATTTTTATTTACTACTATTATAGCATTAAGGTCCGTTTTATGGAAA
TAGAATCAAATGTGTTCAACCCATGGCGTATTTCTGGGTCCATGATCTGGCAGGGCTCTCATACTTCACTCTGATTGGCTTGAACATGTGAGCAC
TCTCTGGCACTAAAGGATCATCTGAATTTGGATCAGTCAGCAAAGAGCAAATGGAAAGCAGCACCTTGGATACAGTAAGGGCAGGGCTCCATTGT
TCCTTTAGGATATCGAGACAAATGCTACCATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E517071] SGN-U206929 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T317944 [Download][View] Facility Assigned ID: cC-smflcSML15F20d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0227 Quality Trim Threshold: 14.5