EST details — SGN-E517107

Search information 
Request: 517107Match: SGN-E517107
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C309788Clone name: cSML-15-G20
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E517107Length: 199 bp (611 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E517107 [] (trimmed) TTTTTTTTTTTTTTTTTTACTAAGCAGCTCCTGTCGTTGGCTCATCCAGTGTAAAACCATCAACTCTCTCCTCAACCTCCTTTTGCAATGAGGAA
GCAGACCCATTGCCCGTTTCACCAGGAACCTCAGATGTTCCTTCTACAACAACGGTAGCTGAGTTTGGTTCTTCTTCTGCCATTGTCAATGACTA
CACTGTGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E517107] SGN-U207394 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T317980 [Download][View] Facility Assigned ID: cC-smflcSML15G20d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0256 Quality Trim Threshold: 12.5