EST details — SGN-E517691

Search information 
Request: 517691Match: SGN-E517691
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310136Clone name: cSML-3-B13
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310136 [cSML-3-B13] Trace: SGN-T318563 EST: SGN-E517690 Direction: 3' Facility: Cereon
Clone: SGN-C310136 [cSML-3-B13] Trace: SGN-T318565 EST: SGN-E517692 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E517691Length: 274 bp (630 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E517691 [] (trimmed) CATCTTCCTCATTCAATCTTCCTTCTCTCCTAGGGTACTGCCCAGCTTGGAGAGTCAAAAGAGTCCATACCATAAGCAGCAAAATGGGGTTCTTG
TCATTTCTCGGAAGGGTCCTCTTTGCTTCAGTTTTCATACTATCTGCTTGGCAAATGTTCAATGAATTTGGGGAAGATGGTGGTCCTGCTGCAAA
GGAATTGGCTCCCAAAGTGGCTGGTCTGCAGGAATTTCTTGAATCCAATCTTGGGGCAGGGGCACCCAAAATTGATGTTAGGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E517691] SGN-U206688 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T318564 [Download][View] Facility Assigned ID: cC-smflcSML3B13b1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.920 Expected Error Rate: 0.0043 Quality Trim Threshold: 20.5