| SGN ID: SGN-C310138 | Clone name: cSML-3-B15 |  | Ordering Not Available |
|
| Library Name: cSML | Organism: Solanum melongena |
Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E517696 | Length: 182 bp (637 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E517696 [] (trimmed)
CACTATCAGAGACCGTTTCTCTAGTACCTCTGATGCCGTTCTCGACCTTCTACTTCCTTCCAAAGCGGAGTTGGCTGTCTCGAAATACCCAAATC
GGGTACTCGTTTATAGTTTGGAGGGCGATTGTCCCATGTTCTTTGACATAGATGGGCGAGTTTATGCTCTGTGGAGAGTCCCCGAAC
[BLAST] [AA Translate]
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: No vector sequence detected
Passed all screens and filters
| Sequence Entropy: 0.980 |
Expected Error Rate: 0.0190 |
Quality Trim Threshold: 20.5 |