| SGN ID: SGN-C310320 | Clone name: cSML-3-L17 |  | Ordering Not Available |
|
| Library Name: cSML | Organism: Solanum melongena |
Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E518061 | Length: 265 bp (602 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E518061 [] (trimmed)
CTTTACTCCGATATCGGCAAGAAGGCCCGAGATCTTCTCTACAGGGACTACCAGACTGACCACAAGTTCACAATTACGACCTACTCTCCTACCGG
AGTCGCTATTACTTCATCTGGACTGAAGAAAGGTGATCTATTTCTGGCTGATGTTAACACTCAATTGAAGAACAAGAATATCACAACTGATATAA
AAGTAGACACGAACTCAAACCTTTTGGCAACTGTTACTGTCGATGAAGCTGCTCCTGGGTTGAAGACAATTTTTA
[BLAST] [AA Translate]
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: No vector sequence detected
Passed all screens and filters
| Sequence Entropy: 0.954 |
Expected Error Rate: 0.0057 |
Quality Trim Threshold: 20.5 |