EST details — SGN-E518061

Search information 
Request: 518061Match: SGN-E518061
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310320Clone name: cSML-3-L17
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E518061Length: 265 bp (602 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E518061 [] (trimmed) CTTTACTCCGATATCGGCAAGAAGGCCCGAGATCTTCTCTACAGGGACTACCAGACTGACCACAAGTTCACAATTACGACCTACTCTCCTACCGG
AGTCGCTATTACTTCATCTGGACTGAAGAAAGGTGATCTATTTCTGGCTGATGTTAACACTCAATTGAAGAACAAGAATATCACAACTGATATAA
AAGTAGACACGAACTCAAACCTTTTGGCAACTGTTACTGTCGATGAAGCTGCTCCTGGGTTGAAGACAATTTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E518061] SGN-U207155 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T318934 [Download][View] Facility Assigned ID: cC-smflcSML3L17b1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0057 Quality Trim Threshold: 20.5