EST details — SGN-E519350

Search information 
Request: 519350Match: SGN-E519350
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C311261Clone name: cSML-7-L8
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C311261 [cSML-7-L8] Trace: SGN-T320222 EST: SGN-E519349 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E519350Length: 265 bp (669 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E519350 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTAACTGAAAGAAGAGCTAGGAGGGGGCCATTAAAAAAACAGTGGGGGGACAAAAACAGCCTAATAGTATCT
TTGATAACAAAAACATCCCTCAAAACTCTTTAATACTAGAAATATTACCATTTCATCAAAATCGCATTCAATCTTTGCTCAGAACCTAAGCTTAG
TGAAGAACCATCGATTTTTCCCGGTCTTGAACCTCTCCTCAAGCCTAGCCTTGGTCTCCTTGGAAGCAGTAACCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E519350] SGN-U206248 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T320223 [Download][View] Facility Assigned ID: cC-smflcSML7L8d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0159 Quality Trim Threshold: 12.5