EST details — SGN-E519737

Search information 
Request: 519737Match: SGN-E519737
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C311492Clone name: cSML-8-H21
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C311492 [cSML-8-H21] Trace: SGN-T320609 EST: SGN-E519736 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E519737Length: 465 bp (606 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E519737 [] (trimmed) GATATTTTAGAGAGGTCTTCTAGATGGCAAAAATGGCTACAGCTTCTTGGTCTGTTTCTTCTTCTTCAATGGAACAGATGCTGTCACTTCCACAT
TCCTCCATGAACATGAGGTTGCGCCATTCCAATGTCCCTTCGTTGCTTCGTCTTTCTTCCCAAGCTGCTATGTCGTCGTTTTCATCGACTTTTAG
GAATCCCTCAGGCTTCCGACATTGCATAGGTTCCAAGAGATTTCCTATCTTCAAGATCAGGGCTTCCTCTTCTGACGAGGAAACATCTGAGTCTG
CTGCTCGCATCAGAAAGGTATTTTCTGATGTAAAAGACGCGTGGGACAGACTCGAAAAGAAACCCACAGTCTCTCTTTATGGAAGTTCTGCAATC
CTTGGTCTTTGGTTATCTTCAATCGTTGCTGATGCATTAGACTCCATACCTCTGTTACCCAAGTTTTTGGAGTTGGCTGGGCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E519737] SGN-U206692 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T320610 [Download][View] Facility Assigned ID: cC-smflcSML8H21d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5