Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E520278

Search information 
Request: 520278Match: SGN-E520278
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C311799Clone name: cSML-9-G17
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C311799 [cSML-9-G17] Trace: SGN-T321152 EST: SGN-E520279 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E520278Length: 432 bp (648 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E520278 [] (trimmed) CTTCTTTGTTATTGTGGTCAACTGACTTGCTGGAAATGGTTGTTTACGCAACTCCTGGCTTGCAAATTCGAGCAGCCAAACAATGCATGTCCCCA
TCTCACAATATTTCAAAACTGAGCAACAAAAGTTTCAGTTTTGGAAGTAAAAGAAAATCTTTTACAGATCTTGGAAGCTCATCACATATCTCGCT
CATGAAGCCAATCCGCAGCTTCAAATTGGCTCCGGTAAAATTGGAAAGGATGATTACAAAAGCAATGTCTGGAACTAGTGAACAAGTGCCAGTTT
CAGGGTTGCCTATTGATCTGAGAGGTAAGAGGGCATTTATTGCTGGCATAGCAGATGACAATGGGTATGGATGGGCAATAGCTAAGTCTCTTGCT
GCTGCAGGGGCTGAAATTCTTGTTGGTACATGGGTGCCTGCACTCAACATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E520278] SGN-U207278 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T321151 [Download][View] Facility Assigned ID: cC-smflcSML9G17c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5