EST details — SGN-E523678

Search information 
Request: 523678Match: SGN-E523678
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C323614Clone name: Petunia-C2H4-1-H05
nocartOrdering Not Available
Library Name: Petunia-C2H4Organism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E523678Length: 307 bp (493 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E523678 [] (trimmed) AGCGGAGAATCAGCTCCCGGATTGCTTCGGTTTCTGAGTTCTTATGGCAGTCTGCTCCTACGTGCTGGAAATAAGGTTTATAGTGAACAAGACAC
ACGTAAAAGCCAAGAGCTTGCAAGTGCACTCTCAATCGAGCGAGAACCTGTTGCTGATCCTGAAATTCGTGTCCAGGCGCTAGAGGCTATTTATT
TGCTCATATTACAGGAAGCAGGCCGAAGAGCATTTTGGACAGTGAATGGACCCCGGATATTGCAAGTCGGTTATGAAGACGAGGATGATCCTAAA
GCGATGGAAGCATATGAGCGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E523678] SGN-U211710 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T333176 [Download][View] Facility Assigned ID: Petunia-C2H4-1-H05.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0141 Quality Trim Threshold: 20.5