EST details — SGN-E526517

Search information 
Request: 526517Match: SGN-E526517
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C326262Clone name: Petunia-C2H4-7-E01
nocartOrdering Not Available
Library Name: Petunia-C2H4Organism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C326262 [Petunia-C2H4-7-E01] Trace: SGN-T333712 EST: SGN-E526421 Direction: Unknown Facility: U Fla ICBR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E526517Length: 332 bp (723 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E526517 [] (trimmed) CAAATCATCTTACAAGGTGGAGATAGTTTCACCAAAAGGAGTTTCTGTTAAAATTAACCCCTCCAAGCTAGCCTTCTCCAAGTTGAACCAGAAGT
TAACGTACCAAGTGACTTTTTCCAAGTCATCAAATAGCTCAATTAATGGTACTGTTGTTCAGGGATTCTTGAAGTGGACTTCTAATAGACACTCT
GTAAGAAGTCCAATTGCAGCTATATTATTAGTTTGATGAAACTACAATAACTTGGATTAATATTTTCAATCTCAAATGTAGAATAAGTGCATAAA
GTACTCTTATTCGATTATAATGAACGTGTTTCTTTTTAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E526517] SGN-U209636 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T334192 [Download][View] Facility Assigned ID: Petunia-C2H4-7RR-E01.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0007 Quality Trim Threshold: 12.5