EST details — SGN-E526907

Search information 
Request: 526907Match: SGN-E526907
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C326652Clone name: PetuniaLF-1-E07
nocartOrdering Not Available
Library Name: Petunia-LFOrganism: Petunia hybrida

Tissue: leaves
Development Stage: various

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E526907Length: 310 bp (701 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E526907 [] (trimmed) CATTAGTCCTCTTGCTTCAGGCGTTCTGACTGGAAAATATAATGCAGGGAACATCCCAGCAGACAGTCGATTTGCTCTGGAAAATTACAAGAATC
TCGCCAGCAGATCTTTGGTGGATGACGTGTTGAGGAAAGTAGATGGACTGAAACCAATTGCTGAGTCACTAGGTGTTCCTCTTCCTCAACTGGCA
ATTGCCTGGTGTGCTGCAAATCCTAATGTCTCATCTGTTATTACTGGTGCCACCAAAGAGTATCAGATTAAAGAGAATATGAAAGCTATCGATGT
CATTCCAATGTTAACACCTGCTGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E526907] SGN-U211411 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T336406 [Download][View] Facility Assigned ID: PetuniaLF-1-E07.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5