EST details — SGN-E527003

Search information 
Request: 527003Match: SGN-E527003
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C327695Clone name: PetuniaRF-1-E07
nocartOrdering Not Available
Library Name: Petunia-RFOrganism: Petunia hybrida

Tissue: whole fruit (ovaries)
Development Stage: several

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E527003Length: 320 bp (675 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E527003 [] (trimmed) GTGATTAGAGCAATGCCTGTTGAGGTCCTCACTAACTCCTACCAAATTTCTCGAAATGAAGCACAGCGCTTGAAGAGGAACAGAGGTGGAGAGAC
TTTCCTGCTATCTCCCCTGCGAAGGTCTTCTTACCACATGAATGGTTTCAACGAAACAATGTAATCCCACCTTGGCTATTGTTTAGCCATGTCTA
CTAGTAATACTAGTTGTTCCTTTTTGTGTTTATTTCTGCACAAGGATAATCCGGAGCTACTTGTACGAGAGCTTTGTTTAGTTAAGAGCAAATAA
TGAATTTAATAAAGCTCCTGCCTTTTTTGAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E527003] SGN-U209868 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T337449 [Download][View] Facility Assigned ID: PetuniaRF-1-E07.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0023 Quality Trim Threshold: 12.5