EST details — SGN-E527211
| Search information |
| Request: 527211 | Match: SGN-E527211 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C327903 | Clone name: PetuniaRF-3-G02 |
| ||
| Library Name: Petunia-RF | Organism: Petunia hybrida |
Tissue: whole fruit (ovaries)
Development Stage: several
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E527211 | Length: 167 bp (603 bp untrimmed) |
| Status: Current Version | Direction: Unknown |
>SGN-E527211 [] (trimmed)
CAAAGGTCTAATGTTGCTATGCAATCTGAATTTAATCGACGTGCCTCGAAAATCGGGTTCGGAATACATCAAACGTCCCAGAAGCTTGCAAAGCT
AGCTAAATTGGCAAAAAGAACTTCTGTTTTATGATGATCCGACCACAAGAAATTCACGGAGCATGACTGCCG
AGCTAAATTGGCAAAAAGAACTTCTGTTTTATGATGATCCGACCACAAGAAATTCACGGAGCATGACTGCCG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E527211] | SGN-U210356 | Petunia hybrida | Build 1 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T337751 [Download][View] | Facility Assigned ID: PetuniaRF-3-G02.g |
| Submitter: Dave Clark | Sequencing Facility: U Fla ICBR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.966 | Expected Error Rate: 0.0206 | Quality Trim Threshold: 14.5 |
Working
