EST details — SGN-E528096

Search information 
Request: 528096Match: SGN-E528096
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C321996Clone name: Petunia-PP-13-A07
nocartOrdering Not Available
Library Name: Petunia-PPOrganism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E528096Length: 240 bp (244 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E528096 [] (trimmed) GGGCTGCAGGAATCGGCACGAGGCACAAAATGGCCAACAGAAACAAATTAACTCCGGTTCATGTTATATGGATCCTTGTTTTATTTGGAACCCTA
ATTTTCATTCTGAATCGATTAGGTGATACGGCTGTCTCATCGGAGCATAAAGACATTAATATTGCACAAAATCATGAGGCGAAAACATCAGAGGA
TTTGGAGCATGTCACGCATAAAGTATACTTTGATGTCGAAATTAATGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E528096] SGN-U211115 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T332422 [Download][View] Facility Assigned ID: Petunia-PP-13-A07.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0026 Quality Trim Threshold: 20.5