EST details — SGN-E533098

Search information 
Request: 533098Match: SGN-E533098
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C312799Clone name: cPHA-11-I11
nocartOrdering Not Available
Library Name: cPHAOrganism: Petunia hybrida

Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E533098Length: 222 bp (673 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E533098 [] (trimmed) GCAAGGACAAGTTCCTCCTACAGAGCACTATCGTGAGTAATGATGCTGACGAACTTCCTCCCGATACTTTTAATAAGGAAAGTGGAAGAACCGTA
GAAGAGTGCAAGCTTAGGGTTGTTTACATCTCTCCTCACTCATCTCCTGGAAATTCTGAAGATGTGTTTAAACAAAGTTCTGATGTCAACTCTGT
AAGTTCTAATTCTAGCCCATAGTCTAGTTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E533098] SGN-U212058 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T325323 [Download][View] Facility Assigned ID: LIB4113-041-Q1-M1-A11
Submitter: Koni Sequencing Facility: Monsanto
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5