Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E533505

Search information 
Request: 533505Match: SGN-E533505
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C313404Clone name: cPHA-14-N16
nocartOrdering Not Available
Library Name: cPHAOrganism: Petunia hybrida

Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E533505Length: 215 bp (572 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E533505 [] (trimmed) GCTGACTTCAAAGAAGCCAAAAATCAGGTTGCAGCTAGCTTTGCAGCTGGAGGATCCATAATGAGTGAGCTAAAGCAATGGAATGAATTATATGG
GGAAGGAGGATCAAGGAAAAAGGAACAGTTATCCTATTTCTTGTAGGATAGGTATGTCGTCTTCCTGCACCCTTCTCGACCATCCATAGAAGTTG
GGCGTCTCAGAAATTTAAGATGCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E533505] SGN-U210605 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T325772 [Download][View] Facility Assigned ID: LIB4113-054-Q1-M1-F4
Submitter: Koni Sequencing Facility: Monsanto
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0118 Quality Trim Threshold: 14.5