Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E533757

Search information 
Request: 533757Match: SGN-E533757
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C313776Clone name: cPHA-15-M5
nocartOrdering Not Available
Library Name: cPHAOrganism: Petunia hybrida

Tissue: stamens
Development Stage: stamens from open flowers on 18-20 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E533757Length: 307 bp (646 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E533757 [] (trimmed) GTTATATGCAAGAGATAGCAATGCTTTTGCTAATGATTTTGGACGTGCAATGGAGAAAGTAAGTGTATATCAAGTCAAGACTGGAAAGCAAGGAG
AAGTGAGGAAGAGATGTGATGCTTTTAATAATGCTCACCCTTGAATGAGAAAGGAGAATGTATATATCTACCATCAAAATTTTATGGTTTTGTTT
GATTTTGAACAATCCAACAACTCTCCATGATATGTAGAAAATATATTTGTGATGATGATATGATCAATGACATTGGATATGAAAATTATTAAGAT
TTGATCAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E533757] SGN-U209509 Petunia hybrida Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T326049 [Download][View] Facility Assigned ID: LIB4113-057-Q1-M1-E5
Submitter: Koni Sequencing Facility: Monsanto
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.898 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5