EST details — SGN-E537906

Search information 
Request: 537906Match: SGN-E537906
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189034Clone name: TUS-56-L24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C45988 [cLEI-10-F21] Trace: SGN-T81781 EST: SGN-E264942 Direction: 5' Facility: TIGR
Clone: SGN-C189034 [TUS-56-L24] Trace: SGN-T338778 EST: SGN-E537903 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537906Length: 291 bp (943 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E537906 [] (trimmed) CTATATCTCTCTCGGTTTACGGAGAAGAAATATAGTTTTAAGGGAGTATTGTCTGTTATTGTTTCCCTTAAGGAATCGGATTAACCCTTGAAGAA
CAAACTTGTTTTCTTGATTAATTGCCTATCCATCACCCCTTTCCCTTTGCTAGGTTGATTGAAATACTCTTTGGAATTTTCTTTTTGCATCTCTG
GGGTGCATTTATTTGCACAAATTTTGATTTCCTTTTTCGTTAAAATGCGAACAGAAGTTTCGCCGCCTCAAGATTGCTTGATTGACTAGTTCAAG
GAACCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537906] SGN-U590719 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338781 [Download][View] Facility Assigned ID: TUS56L24_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0471 Quality Trim Threshold: 14.5