EST details — SGN-E540325

Search information 
Request: 540325Match: SGN-E540325
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190492Clone name: TUS-60-I18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C75662 [cLES-14-P2] Trace: SGN-T100727 EST: SGN-E286906 Direction: 5' Facility: TIGR
Clone: SGN-C190492 [TUS-60-I18] Trace: SGN-T341203 EST: SGN-E540328 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540325Length: 493 bp (905 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E540325 [] (trimmed) CCCCAAAAATTTTGGGCCCTGCTTAACCCAATTTGTAAAATTCGTCCTTCCAACTTTTTTGGGGACAACGGGCTTTCAAAACCCCTTTAAAACTT
TTCTTTGGGAAAATAAACCCTCTGGCTTTGACAACTAAACCCGTTTTTACGGGTGCTCATCGGAAATTAAAATTGGACATTTCTCTCCCCCCCAT
GTTTGGATTCTGATAGGAGTTCCCCTCAAATGTTTTAGGAGCGTACCTTTGGTTTGGCCCTGGACCTGTTTGGAAAGGGGGGTCCCCTTTGTTCT
GCCCCCCCCCTTTGTTTGGGAAATTCCCGGGGTTGTTGGGCCTTCCGAATTTTTTGGGGGGCCCCCCCCCCTGGTTGGGGGGCATATTCGGGGGG
GGCATCCCCCCCCCACGGGGGGGCCCTCTCTTGTCCGGGTGTTGTTTCCCGCCTGTATGAGGGGGGGGCCCCCCTTAGCCTTGTGTGCTGATGGG
GGGGCCCTTTCAGGGTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540325] SGN-U604657 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341200 [Download][View] Facility Assigned ID: TUS60I18_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.866 Expected Error Rate: 0.0262 Quality Trim Threshold: 14.5