EST details — SGN-E542558

Search information 
Request: 542558Match: SGN-E542558
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191792Clone name: TUS-63-O22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90377 [cLEW-22-F15] Trace: SGN-T113956 EST: SGN-E301058 Direction: 5' Facility: TIGR
Clone: SGN-C191792 [TUS-63-O22] Trace: SGN-T343436 EST: SGN-E542561 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E542558Length: 474 bp (914 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E542558 [] (trimmed) GGCCTTCAACCGGTAATATGCATTATCACCATGAAAATATAGTGGCACATAACAATCGATAAATTTGCTCAGTAAAAAGTTTTAAAAAAGGAGGG
AAAGGAAACACCAATTTGAGTTTATTGATACACTTACCACATGGTGGTCATCATTCATTCCTCCCGGGAAGAAATGAACCAAAAACATTCTAAAA
ACAGCACAAGCTGACCAAAACTAACTCCCATTAACGTCTATGAAATGAATACAGTAATAGCCAACCAGCCAAACACCCCCTTCAGAAAAATTTGT
GTTCCTATTGGAATTCCAGTAAAAACAGATATATCGATTACCATAAGTGCCTCAATTTGAGAATTCAGTTTAAGGACTGAATTACTGTGGGTTGT
AGTCCACCATAAAGAATTTCTCCAGCTGAAGAAACAATGGATTTGCATATTCCACATGAACAGGATGAGCTATATACTCTGCAACACCTTCTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E542558] SGN-U590685 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T343433 [Download][View] Facility Assigned ID: TUS63O22_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0264 Quality Trim Threshold: 14.5