EST details — SGN-E546092

Search information 
Request: 546092Match: SGN-E546092
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193846Clone name: TUS-69-E12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C101385 [cLHT-18-H9] Trace: SGN-T170578 EST: SGN-E355736 Direction: 5' Facility: TIGR
Clone: SGN-C193846 [TUS-69-E12] Trace: SGN-T346968 EST: SGN-E546093 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E546092Length: 316 bp (858 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E546092 [] (trimmed) GAAAAAAGAACGAGGATTTTACTCATAAAATAGTTGGTATAAAAAATTTTTACACCATCATTGTTCAGAAGTTAAACGAAATATAACGTGTCCCT
TTTACTTGTTGCCAATCGACAGGTGTCAAACCTTATATACCGGGATGAACCAACTGGAACTGGTTTCAGTTATCCTTCTGATGAAAGTGACATTC
GACACAATGAGACTGGTGTAAGCAATGACCTTTATGATTTCCTACAGGTTTGTTCCCTTCACCCCTTGTCGGTATTTCTCAGAATCCACGTTGTG
AGATTACACGAGTGTGCCACACTTTGATGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E546092] SGN-U593892 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346967 [Download][View] Facility Assigned ID: TUS69E12_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0282 Quality Trim Threshold: 14.5