Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E546934

Search information 
Request: 546934Match: SGN-E546934
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194336Clone name: TUS-70-I22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C107232 [cLPP-4-L14] Trace: SGN-T175978 EST: SGN-E363541 Direction: 5' Facility: TIGR
Clone: SGN-C194336 [TUS-70-I22] Trace: SGN-T347810 EST: SGN-E546935 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E546934Length: 463 bp (855 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E546934 [] (trimmed) CAATAAAAATATCACTCTTGTAAACATACAGATTACACTGAATACAAACAGAGAACTCAAATTTCTAGAAATCAATGTAATTACATCTTCTTTTT
CTTTTCACGGGAATCGATTCATACTTCCACAATACCTACACTTACTCTATCACAAGGAAAGAAAACTAAAACTAAAACTTAAACAAAACATAACT
TATGGGAACCATTTCTTTCTTATCCTATTTTCCATTCTTCTACAGTCAAAATATCTTCAATCTACTTATCTCCTTTTTACTGATGCATCAAATTA
TATGCACATAAGAGGATCGTTAGCTAACAAGGTCTGCCAGGTTTGCACTTGAGCACACCAGCAAAGCGAGTGAGTCGTCCTGCATGTGAACCAGG
CTTGAACTTGATCTTATGATTTTTTGTCAATGCATGTTTTTTCTTGTCTTGTGGCCCTGACTCCACAAAATAAGCTCCATTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E546934] SGN-U597209 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T347809 [Download][View] Facility Assigned ID: TUS70I22_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0014 Quality Trim Threshold: 20.5