EST details — SGN-E547157

Search information 
Request: 547157Match: SGN-E547157
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194466Clone name: TUS-70-O8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C108255 [cLPP-8-F7] Trace: SGN-T172398 EST: SGN-E360522 Direction: 5' Facility: TIGR
Clone: SGN-C194466 [TUS-70-O8] Trace: SGN-T348033 EST: SGN-E547158 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547157Length: 451 bp (884 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E547157 [] (trimmed) TTTTGAAATCTACAGTGAGCCTGGGTCAACTGGGACGGCTACATGAGGAATTCTGTAGGTGGTGTCACAGTAGTCCCTGGACTTCTGGAGAATGT
TCTAATGGTTGACTCCTGGCTCAGTGGCGACGTGACAGGACAAAACAATTTTCCCTATAGTGATGGCCCAAACATGTAGGTCATGAACATCTTTT
ACTCCTGCTAAAGATTTTAGGCCATTCTCGAGTTGAACGATATCAACTTCCTTTGGTGTCCTCTCCATCAATAAGGAAAATATAGTCTTAAGCAT
GGGTACAGTTGTACTAAGAGCAAAGATTGAGAAAAAAATAGTACAGAGAAGATCAACCACCAACCATTCTGGTTTGTACCACATAATAGCTCCAG
CAATCATCACACCAACAGATTGTATTAAATCAGATATAACATGCGGGTAAGCCCCTTCAATATTTATGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547157] SGN-U589205 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T348032 [Download][View] Facility Assigned ID: TUS70O08_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0029 Quality Trim Threshold: 20.5