EST details — SGN-E549284
| Search information |
| Request: 549284 | Match: SGN-E549284 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C193739 | Clone name: TUS-69-A1 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
See unigene SGN-U581121 for alternative clones/ESTs which are mapped
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E549284 | Length: 226 bp (818 bp untrimmed) |
| Status: Current Version | Direction: 3' |
>SGN-E549284 [] (trimmed)
GCATTCATATGTAACTCCAACGAGCTACATCAAATAATTCTGAACGAAATCCAAGGAAAAGCCAACAAGAATCTCCTAGGATCGAAACGTATATA
AAAGAGTTCACAGTAAATATACAAGCATCCAAGAAATTTTGGTATATAATGACTATATGATACATCAAGGACAAATCTCAAACCAAGCATTTAGA
TGACGACATGCCCAAACAAATTGATTAAACATTACC
AAAGAGTTCACAGTAAATATACAAGCATCCAAGAAATTTTGGTATATAATGACTATATGATACATCAAGGACAAATCTCAAACCAAGCATTTAGA
TGACGACATGCCCAAACAAATTGATTAAACATTACC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E549284] | SGN-U581121 | Tomato 200607 | Build 2 | 81 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T350159 [Download][View] | Facility Assigned ID: TUS69A01_P1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.947 | Expected Error Rate: 0.0330 | Quality Trim Threshold: 14.5 |
Working
